• Question: How can you tell the distance between strains of bacteria in terms of genetic material?

    Asked by to Bethany on 20 Jun 2014. This question was also asked by .
    • Photo: Bethany Dearlove

      Bethany Dearlove answered on 20 Jun 2014:

      This is a brilliant question! The simplest answer is the number of changes between the two sequences. For example, if we have:
      Strain1: ATCGTACTGCACAATCGTTTACCATACGTC
      Strain2: ATGGTACTGCACAATCGTCTACCTTACGTC
      then there are 3 mutations (shown in bold) out of a total of thirty nucleotides (A, C, G or Ts), and therefore the genetic distance is 3/30 or 10%.

      I say simplest, as there are different models of mutation that we might take into account to allow for the biology of an organism. For example mutations between (A and G) and (C and T), known as transitions, have been found to occur naturally more often than mutations between other combinations (AC, AT, CG,GT), known as transversions.

Comments